• Prices

    • Prices range from $13 to $1800
      Min
      Max
      to

  • Stores

      • <Choose Stores
      • <Local Stores
  • Colors

    • <Pick Colors
  • Brands

    • <Select Brands

Product Search

  • Voice v.10.0 Pro USB Edition

    IBM ViaVoice Pro USB Edition is the flagship offering of the ViaVoice for Windows, Release 10 product line. It represents the merger of high-productivity software with advanced microphone technology. Pro USB Edition offers great dictation versatility; dictate, edit, and correct text in SpeakPad, the resident speech-enabled word processor, or in Word, Excel, and other applications within the Microsoft Office product suites, including Office XP, or directly into a variety of other PC applications. Pro USB

    $191.33
    shopubs
  • Classical Music CD Mahler: Symphony No. 1 Chitose Okashiro Piano Transcription

    Gustav Mahler (1860-1911) Symphony No.1 in D Major "Titan" Solo Piano Transcription: Chitose Okashiro, Based on 4 Hands Version by Bruno Walter Chitose Okashiro, Piano Langsam. Schleppend. Wie ein Naturlaut 14'38" Kraftig bewegt 07'39" Feierlich und gemessen, ohne zu schleppen 12'06" Sturmisch bewegt 21'12" Real Player sample 1 sample 2 Click the above icon to download free Real Player. Windows Media Player sample 1 sample 2 PPRC10001 World: Classical Music CD Mahler: Symphony No. 1 Chitose Okashiro Piano

  • Start-Stop Network Pro Upgrade

    Start-Stop Network Pro Upgrade Automatically Share Work among Multiple Transcribers using the Start Stop Universal Transcription System! The Start-Stop Network Pro Upgrade alerts every transcriptionist on your office or shared network, via Start Stop's built-in Job Manager. Each transcriptionist can now check out a job, and all other Job Managers in the office will show that the file is being transcribed, and by whom . The transcriptionist who completed the job can mark it DONE, and all other

  • ITC ProTime PRO Analyzer Promotion

    ITC ProTime PRO Analyzer Promotion ITC *R* ProTime Promotion $239.90 The ProTime® system is designed to safely monitor oral anticoagulation therapy. The test procedure is simple, safe, and accurate. As well, the new ProTime is EMR ready. The ProTime® Microcoagulation System for prothrombin time testing is designed to safely manage Coumadin® therapy. Kit Includes: 2 Boxes of ITC Protime 1-Channel Test Box/25 ITC ProTime PRO Analyzer (with signed contract to purchase 2 Boxes per Month for 2 Years) ITC Protime

  • Teach Yourself Pro

    Teach Yourself Pro v 1.6.0.6 Shareware $79.95 Original technology of the accelerated teaching or psychological correction at a level of subconsciousness. Makes active concentration of attention and memory. Psychology. Psychoanalysis. The study of any foreign language by the accelerated technique (algorithms subsensory, virtual and audiovisual modes of teaching). Suggestive technologies (e.g. hypnosis). Trainings to activation of retention at a level of subconsciousness (light stimulation, binaural effect).

    $79.94
    zonator
  • Promega Enzyme Recomb Rnasin 10000U N2515

    » Promega Enzyme Recomb Rnasin 10000U N2515 Promega Enzyme Recomb Rnasin 10000U N2515 PM-ME-N2515 Promega Enzyme Recomb Rnasin 10000U N2515 / PAN2515 Promega Enzyme Recomb Rnasin 10000U N2515 Promega Corporation Kits or enzymes for sequencing These modifying enzymes can be used in multiple applications. Each modifying enzyme is guaranteed through the date printed on the vial. Most have a 24-month shelf life. They are offered in convenient, cost-effective concentrations and various sizes. Ordering

  • Promega RNASIN(R) Rnase Inhibit 2500U N2111

    » Promega RNASIN(R) Rnase Inhibit 2500U N2111 Promega RNASIN(R) Rnase Inhibit 2500U N2111 PM-ME-N2111 Promega RNASIN(R) Rnase Inhibit 2500U N2111 / PAN2111 Promega RNASIN(R) Rnase Inhibit 2500U N2111 Promega Corporation Kits or enzymes for sequencing These modifying enzymes can be used in multiple applications. Each modifying enzyme is guaranteed through the date printed on the vial. Most have a 24-month shelf life. They are offered in convenient, cost-effective concentrations and various sizes. Ordering

  • Cipro, Ciproxin

    Cipro, Ciproxin Synonyms: Bacquinor, Baycip, Bernoflox, Ciprofloxacin HCl, Ciflox, Cifloxin, Ciloxan, Ciprinol, Cipro, Cipro I.V., Cipro XL, Cipro XR, Ciprobay, Ciprocinol, Ciprodar, Ciprofloxacin Base, Ciprofloxacin dihydrochloride, Ciprofloxacin hydrochloride, Ciprofloxacin monohydrochloride, Ciprofloxacina, Cipromycin, Ciproquinol, Ciproxan, Ciproxin, Flociprin, Floxin, Floxin Otic, Ocuflox, Ofloxacin, Proquin XR, Septicide, Velomonit Indication : For the treatment of the following infections caused by

  • is designed to support serious mass gain through the most effective pro-anabolic pathways.

    is designed to support serious mass gain through the most effective pro-anabolic pathways. PLEASE NOTE: are now being liquidated. This product is available in VERY LIMITED QUANTITIES. Manufacturer has ceased product production as of 11/6/09. FINAL INVENTORIES Bad Ass Mass When you want...Superior Mass! When you need...Superior Strength! Pro-Anabolic Matrix for Mass Gain Through Effective Pathways! Stimulates muscle AR's for enhanced protein synthesis and tissue repair Binds SHBG to increase levels of free

  • ITC ProTime Pro Analyzer Instrument

    ITC ProTime Pro Analyzer Instrument ITC *R* ProTime Pro $1356.99 The ProTime® system is designed to safely monitor oral anticoagulation therapy. The test procedure is simple, safe, and accurate. As well, the new ProTime is EMR ready. Results in minutes Easy to operate No calibration required Easy-to-read back-lit display prompts the user through the test Rechargeable and user replaceable battery Accepts and stores patient and/or operator ID for reduced transcription errors Auto-send results quickly and

  • Promega T7 Rna Polymerase 5000U P2077

    » Promega T7 Rna Polymerase 5000U P2077 Promega T7 Rna Polymerase 5000U P2077 PM-ME-P2077 Promega T7 Rna Polymerase 5000U P2077 / PAP2077 Promega T7 Rna Polymerase 5000U P2077 Promega Corporation Kits or enzymes for sequencing These modifying enzymes can be used in multiple applications. Each modifying enzyme is guaranteed through the date printed on the vial. Most have a 24-month shelf life. They are offered in convenient, cost-effective concentrations and various sizes. Ordering Information: Each

  • Microsoft Digital Media Pro Keyboard

    Microsoft Digital Media Pro Keyboard Customer Reviews Review 51 to 55 of total 152 Fun to type again by Chuck, 2006-11-02 This is a superb keyboard. Great feel...wonderful features...had no idea how much difference there was between keyboards til I got this beauty. Great keyboard , by P. L. Finnin, 2006-11-03 I do medical transcription for a major University Hospital and really pound a keybord every day. I find the ergo ones uncomfortable and this is your standard keyboard - durable. They're getting hard to

  • Philips LFH-9370 Digital Pocket Memo 9370 Pro

    Philips LFH-9370 Digital Pocket Memo 9370 Pro 1540 Price:$259.00 Rating: Yes this recording makes just standard DSS audio format files. This recorder is backward compatible will all the transcription kits you have. The Digital Pocket Memo 9370 is always ready to take your dictation. Handy, powerful and efficient, you can easily control the latest recording technology with push buttons. With the exchangeable SD card, you have virtually unlimited recording capacity and the .dss file format produces excellent

    $279.00
    • Sale
  • lisch7-prov Gene, Xenopus tropicalis liver-specific bHLH-Zip transcription factor 7, GenScript ORF Clone: NM_001015935

    Xenopus tropicalis liver-specific bHLH-Zip transcription factor 7 (lisch7-prov), mRNA. (cDNA Clone, ORF Clone) » lisch7-prov Gene, Xenopus tropicalis liver-specific bHLH-Zip transcription factor 7, GenScript ORF Clone: NM_001015935 GN053933 lisch7-prov NM_001015935 Description: >lisch7-prov Length: 1788 atggaagggactgcgattcc catggaattcaagttaccgt accttaaagtgcacttacca aagtcgttctgtcgcgatcg atcaatagccagctgcagca agttccaggacggtgaggat ttctaccaagggcggagaat gcatggggcgacagcggcgt aataacgaggcctactctga

  • ICD-MX20 Digital Voice Recorder, 32MB Built-In Memory, Memory Stick PRO Duo Slot

    Digital Voice Recorders ICD-MX20 Digital Voice Recorder, 32MB Built-In Memory, Memory Stick PRO Duo Slot Manufacturer: SONY CORPORATION SONICDMX20 This voice-activated digital voice recorder features a navigation/menu key, PC transcription, memory capacity indicator, microphone sensitivity control, real-time counter, file search (forward and reverse) and clock and calendar functions. Records up to 11 hours/35 min. 32MB base memory. Normal playback speed control, automatic download, e-mail function and auto

    $237.17
  • Philips LFH-7277 PRO Transcription Kit (LFH7277)

    A powerful and user-friendly digital transcription system that turns your computer into a highly sophisticated transcription machine.

    $379.00
    • Free Shipping
  • Olympus AS-4000 PRO Transcription Kit

    The AS-4000 combines with any professional digital voice recorder from Olympus to provide a complete, end-to-end business solution.

    $329.00
    • Free Shipping
  • Olympus AS-5000 PRO Transcription Kit

    The New AS-5000 PC transcription kit includes the DSS Player Pro R5 Transcription Module, the RS27 Foot Switch and the new E62 Stereo Headset, which is more durable and static-free than its predecessors.

    $347.00
    • Free Shipping
  • Olympus AS-4000 PRO Transcription Kit

    » Olympus AS-4000 PRO Transcription Kit Product Information The AS-4000 combines with any professional digital voice recorder from Olympus to provide a complete, end-to-end business solution. Complete with footswitch, headset, and powerful software, the AS-4000 can easily be integrated into the workflow of any office system and significantly streamline data sharing and distribution of dictations between professionals, departments, and office locations. Special E-mail and FTP functions enable dictation files

    $345.00
  • OLYMPUS AS-5000 PRO TRANSCRIPTION KIT #147584

    The New AS-5000 PC transcription kit is a complete digital dictation and transcription system for businesses of all types and sizes. Improve workflow, efficiency and organization with this top-rated Olympus product. The AS-5000 kit includes the DSS Player Pro R5 Transcription Module, the RS27 Foot Switch and the new E62 Stereo Headset, which is more durable and static-free than its predecessors. Key Features DSS Player Pro Software is Windows and Apple Macintosh compatible. Automatic retrieval of typed

    $347.00